ID: 1094759614

View in Genome Browser
Species Human (GRCh38)
Location 12:33515760-33515782
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094759614_1094759620 11 Left 1094759614 12:33515760-33515782 CCACCTGTAGCTGAACTACGCCA No data
Right 1094759620 12:33515794-33515816 CTAATTGTTGTAGGTTAAATTGG No data
1094759614_1094759618 2 Left 1094759614 12:33515760-33515782 CCACCTGTAGCTGAACTACGCCA No data
Right 1094759618 12:33515785-33515807 GCCATGGCTCTAATTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094759614 Original CRISPR TGGCGTAGTTCAGCTACAGG TGG (reversed) Intergenic
No off target data available for this crispr