ID: 1094763413

View in Genome Browser
Species Human (GRCh38)
Location 12:33561706-33561728
Sequence GTGTGGGCATGGTGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094763413_1094763421 3 Left 1094763413 12:33561706-33561728 CCATCATCCCACCATGCCCACAC No data
Right 1094763421 12:33561732-33561754 AGGCATGGTGTACAATCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094763413 Original CRISPR GTGTGGGCATGGTGGGATGA TGG (reversed) Intergenic
No off target data available for this crispr