ID: 1094764416

View in Genome Browser
Species Human (GRCh38)
Location 12:33575784-33575806
Sequence CAAAGCAAATAGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094764416_1094764425 4 Left 1094764416 12:33575784-33575806 CCTCCTTCCTTCTATTTGCTTTG No data
Right 1094764425 12:33575811-33575833 GTTGGGGTAGATTTCTGTTGGGG No data
1094764416_1094764424 3 Left 1094764416 12:33575784-33575806 CCTCCTTCCTTCTATTTGCTTTG No data
Right 1094764424 12:33575810-33575832 AGTTGGGGTAGATTTCTGTTGGG No data
1094764416_1094764423 2 Left 1094764416 12:33575784-33575806 CCTCCTTCCTTCTATTTGCTTTG No data
Right 1094764423 12:33575809-33575831 GAGTTGGGGTAGATTTCTGTTGG No data
1094764416_1094764427 17 Left 1094764416 12:33575784-33575806 CCTCCTTCCTTCTATTTGCTTTG No data
Right 1094764427 12:33575824-33575846 TCTGTTGGGGCAGACCCTGTGGG No data
1094764416_1094764428 18 Left 1094764416 12:33575784-33575806 CCTCCTTCCTTCTATTTGCTTTG No data
Right 1094764428 12:33575825-33575847 CTGTTGGGGCAGACCCTGTGGGG No data
1094764416_1094764426 16 Left 1094764416 12:33575784-33575806 CCTCCTTCCTTCTATTTGCTTTG No data
Right 1094764426 12:33575823-33575845 TTCTGTTGGGGCAGACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094764416 Original CRISPR CAAAGCAAATAGAAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr