ID: 1094775765

View in Genome Browser
Species Human (GRCh38)
Location 12:33725503-33725525
Sequence TTGGCTAGATTCACCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094775765_1094775766 -9 Left 1094775765 12:33725503-33725525 CCAGGATGGGTGAATCTAGCCAA No data
Right 1094775766 12:33725517-33725539 TCTAGCCAATGAATGAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094775765 Original CRISPR TTGGCTAGATTCACCCATCC TGG (reversed) Intergenic
No off target data available for this crispr