ID: 1094781303

View in Genome Browser
Species Human (GRCh38)
Location 12:33795195-33795217
Sequence CTGCTGGCACATTTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094781303_1094781313 28 Left 1094781303 12:33795195-33795217 CCCACCCCCAAATGTGCCAGCAG No data
Right 1094781313 12:33795246-33795268 TGGGAGTGATGCCAGCAAGATGG No data
1094781303_1094781311 8 Left 1094781303 12:33795195-33795217 CCCACCCCCAAATGTGCCAGCAG No data
Right 1094781311 12:33795226-33795248 AAATATAAAAAGAGCTAAGTTGG No data
1094781303_1094781312 9 Left 1094781303 12:33795195-33795217 CCCACCCCCAAATGTGCCAGCAG No data
Right 1094781312 12:33795227-33795249 AATATAAAAAGAGCTAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094781303 Original CRISPR CTGCTGGCACATTTGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr