ID: 1094785625

View in Genome Browser
Species Human (GRCh38)
Location 12:33845681-33845703
Sequence GCCATTAAGTCATATAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094785624_1094785625 0 Left 1094785624 12:33845658-33845680 CCTTAATTATTTGAAAGAACTTA No data
Right 1094785625 12:33845681-33845703 GCCATTAAGTCATATAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094785625 Original CRISPR GCCATTAAGTCATATAATAC TGG Intergenic
No off target data available for this crispr