ID: 1094789681

View in Genome Browser
Species Human (GRCh38)
Location 12:33897602-33897624
Sequence ACTAATAACCAGAATCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094789679_1094789681 23 Left 1094789679 12:33897556-33897578 CCACAGAGTGGGAGAAAATATTT 0: 125
1: 1759
2: 3847
3: 4310
4: 4022
Right 1094789681 12:33897602-33897624 ACTAATAACCAGAATCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094789681 Original CRISPR ACTAATAACCAGAATCTAGA AGG Intergenic
No off target data available for this crispr