ID: 1094789681 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:33897602-33897624 |
| Sequence | ACTAATAACCAGAATCTAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1094789679_1094789681 | 23 | Left | 1094789679 | 12:33897556-33897578 | CCACAGAGTGGGAGAAAATATTT | 0: 125 1: 1759 2: 3847 3: 4310 4: 4022 |
||
| Right | 1094789681 | 12:33897602-33897624 | ACTAATAACCAGAATCTAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1094789681 | Original CRISPR | ACTAATAACCAGAATCTAGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||