ID: 1094800077

View in Genome Browser
Species Human (GRCh38)
Location 12:34022792-34022814
Sequence CACCCCAGGAGAGGCCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 291}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094800060_1094800077 17 Left 1094800060 12:34022752-34022774 CCATTTCTCCCTTTCCCAGGTGG 0: 2
1: 0
2: 3
3: 59
4: 421
Right 1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG 0: 1
1: 1
2: 0
3: 38
4: 291
1094800066_1094800077 3 Left 1094800066 12:34022766-34022788 CCCAGGTGGGGTCCCCAACCTGT 0: 1
1: 1
2: 0
3: 10
4: 122
Right 1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG 0: 1
1: 1
2: 0
3: 38
4: 291
1094800065_1094800077 8 Left 1094800065 12:34022761-34022783 CCTTTCCCAGGTGGGGTCCCCAA 0: 1
1: 1
2: 2
3: 20
4: 199
Right 1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG 0: 1
1: 1
2: 0
3: 38
4: 291
1094800067_1094800077 2 Left 1094800067 12:34022767-34022789 CCAGGTGGGGTCCCCAACCTGTC 0: 1
1: 1
2: 0
3: 8
4: 121
Right 1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG 0: 1
1: 1
2: 0
3: 38
4: 291
1094800068_1094800077 -9 Left 1094800068 12:34022778-34022800 CCCCAACCTGTCCCCACCCCAGG 0: 1
1: 1
2: 9
3: 91
4: 772
Right 1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG 0: 1
1: 1
2: 0
3: 38
4: 291
1094800070_1094800077 -10 Left 1094800070 12:34022779-34022801 CCCAACCTGTCCCCACCCCAGGA 0: 2
1: 0
2: 3
3: 62
4: 517
Right 1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG 0: 1
1: 1
2: 0
3: 38
4: 291
1094800064_1094800077 9 Left 1094800064 12:34022760-34022782 CCCTTTCCCAGGTGGGGTCCCCA 0: 1
1: 1
2: 0
3: 25
4: 275
Right 1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG 0: 1
1: 1
2: 0
3: 38
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094800077 Original CRISPR CACCCCAGGAGAGGCCTGAG AGG Intronic
900477460 1:2882609-2882631 CAACCCAGCAGAGGCCTCATAGG - Intergenic
901012963 1:6211395-6211417 CACCCCAGGGGAGGCTGCAGTGG - Intronic
901038727 1:6351570-6351592 GCCCCCAGGACAGGCCTGTGTGG - Intronic
901457548 1:9371862-9371884 AACCCGAGGAGAGCCATGAGCGG - Intergenic
901511128 1:9718536-9718558 CAGCACAGGGAAGGCCTGAGGGG - Intronic
901880727 1:12192340-12192362 AGCCCTAGGAGAGGTCTGAGGGG - Intronic
902329290 1:15723202-15723224 CACCCAAGAGGAGCCCTGAGAGG - Intronic
904334102 1:29785819-29785841 CTCCCCAGCAGGGGCCTGAGAGG - Intergenic
905276831 1:36823953-36823975 CACCTCAAGAGAGGTGTGAGTGG + Intronic
905340471 1:37274244-37274266 CACCCCAGGCTAGGCCCTAGTGG + Intergenic
905522610 1:38612147-38612169 TCCCCCAGGTGAGGCCTGAAGGG - Intergenic
906122422 1:43403286-43403308 CACCCCAGGAGATGCTGGTGAGG + Exonic
906988166 1:50709236-50709258 AACCCAAGTAGAGGCCTGAAAGG - Intronic
909343813 1:74561834-74561856 TACTCCAGAAGAGGCCTCAGCGG + Intergenic
912516548 1:110219991-110220013 CAGCCCTGGAGAGGCCACAGTGG + Intronic
915304177 1:154968580-154968602 CTCCCCAGGATAGAGCTGAGCGG + Exonic
915601208 1:156924266-156924288 CAACCCAGCAGAGGCGCGAGTGG + Intronic
915839346 1:159202440-159202462 ACGCCAAGGAGAGGCCTGAGAGG - Intronic
918124184 1:181568297-181568319 CGCCCCAGGAATGGCCTGTGGGG + Intronic
919897521 1:202018489-202018511 CAGCCCAGGACACACCTGAGGGG - Intergenic
919899756 1:202035079-202035101 CACCCCAGGACGGGCCTTTGAGG - Intergenic
921396665 1:214675875-214675897 CACCCCAGGAAAGGCCCTGGTGG - Intergenic
921978351 1:221227574-221227596 CTCCCCAGATGAGGCTTGAGTGG + Intergenic
922729561 1:227942579-227942601 GACCTCAGCAGAGGGCTGAGAGG - Intronic
1062855384 10:777458-777480 CACGCCAGGGGAGGCCTGTGGGG - Intergenic
1062982470 10:1736977-1736999 GACCCCATGAGAGGCCGGGGTGG + Intronic
1063720994 10:8581263-8581285 CCCACCAGGAGAGACCAGAGAGG + Intergenic
1064013548 10:11755526-11755548 CACCCCAGGAGTGGCAAAAGAGG - Exonic
1064031710 10:11887056-11887078 CCCCGCAGGAGGGGTCTGAGGGG + Intergenic
1065898500 10:30184892-30184914 AAACTCAGGAGAGACCTGAGTGG - Intergenic
1067523624 10:47025899-47025921 ATCCCCAGGAGGGGCCAGAGTGG - Intergenic
1067582276 10:47453137-47453159 GCCCCCAAGGGAGGCCTGAGGGG - Intergenic
1067693674 10:48520382-48520404 CAGCCCAGGAGGGGCCTAAGGGG + Intronic
1069552960 10:69377101-69377123 CACCCCAAGAAAGCCTTGAGGGG - Intronic
1070065559 10:73030215-73030237 CACTTCAGGAGATGCTTGAGAGG - Intronic
1071545282 10:86524304-86524326 CCCTCCAGGAGGGGCCCGAGGGG - Intergenic
1071553268 10:86583876-86583898 CACTCCAGAGGAGGCCTGAGGGG - Intergenic
1072308734 10:94133613-94133635 CACCCCTAGACAGGCCTAAGAGG + Intronic
1072944387 10:99796788-99796810 CCCCCAAGGAGATGCCAGAGTGG + Intronic
1073541036 10:104316236-104316258 CACCCCAGGGTAGGCCTTTGGGG - Intronic
1073825132 10:107312132-107312154 CACGCAAGGAAAGGACTGAGGGG - Intergenic
1074757173 10:116632643-116632665 CTCCCCAGGAGTTACCTGAGAGG - Intronic
1075058193 10:119235868-119235890 TGCCCCAGGAGATTCCTGAGGGG + Intronic
1075654720 10:124153302-124153324 CACCCCAGCAGAGGAAGGAGAGG + Intergenic
1075816039 10:125265475-125265497 CACCCCAGGTGGGTCCTGTGAGG + Intergenic
1076246293 10:128950092-128950114 ACCCCCAGGTGAGGCCTGGGAGG + Intergenic
1076606811 10:131694737-131694759 CACCGCAGGGCAGCCCTGAGGGG - Intergenic
1077178612 11:1202566-1202588 CATCCCAGGAGTGGGCAGAGGGG + Intergenic
1077407500 11:2389169-2389191 AACCCCAGGAGAGGTCTGAAGGG + Intronic
1077485610 11:2837205-2837227 CGCCCGGGGAGAGGCCTGGGTGG + Intronic
1077670301 11:4151312-4151334 GACCCCAGGAGAGGGCTGGGTGG + Intergenic
1079677143 11:23243423-23243445 TATACCAGGAGAGGCCTGAGTGG + Intergenic
1081408521 11:42726857-42726879 TACCCCACGAGAGGCCTATGAGG + Intergenic
1081695400 11:45105870-45105892 CACCCCTGGAGAGGCCTCTGTGG - Intronic
1081876377 11:46411171-46411193 CGCCCCTGGGGCGGCCTGAGCGG + Intronic
1082163325 11:48908759-48908781 CACCGAAAGACAGGCCTGAGAGG - Intergenic
1082238077 11:49843972-49843994 CACCGAAAGATAGGCCTGAGAGG + Intergenic
1082611372 11:55302476-55302498 CACCGAAAGATAGGCCTGAGAGG + Intergenic
1083902533 11:65650561-65650583 CACCCCAGGAGAAGGCGGACAGG + Exonic
1084592934 11:70100922-70100944 CAGCACAGAGGAGGCCTGAGCGG + Intronic
1084907313 11:72358041-72358063 CTCCCAAGGAGAGGCAGGAGTGG + Intronic
1086498804 11:87431401-87431423 CACCCTAAGAAAGGCCTGTGTGG + Intergenic
1086696347 11:89850757-89850779 CACCGAAAGATAGGCCTGAGAGG - Intergenic
1086709811 11:89993732-89993754 CACCGAAAGATAGGCCTGAGAGG + Intergenic
1088914938 11:114220310-114220332 CACCACAGTGGAGGCCTGAATGG - Intronic
1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG + Intronic
1089638615 11:119832481-119832503 GAACCCAGGAGAGACCTGGGTGG + Intergenic
1090005629 11:123000041-123000063 CACCCGAGGATAGGCCGGCGTGG + Intergenic
1090843067 11:130509300-130509322 CACACCAGCAAAGGCCAGAGGGG - Intergenic
1091086614 11:132727431-132727453 CTCCCCAGGAGAGCCCTGGCTGG - Intronic
1094415770 12:30213322-30213344 CTTCCCAGGAGAGGCCTCAGGGG - Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG + Intronic
1096792438 12:54053510-54053532 GGGCCCAGCAGAGGCCTGAGGGG + Intronic
1098311900 12:69156993-69157015 GACCCCAGAAGGGGTCTGAGGGG - Intergenic
1102039686 12:109792833-109792855 GACCACAAGAGAGGCCAGAGGGG + Intronic
1102795213 12:115683390-115683412 CAACCCAGGACAGGCCGCAGGGG - Intergenic
1102992168 12:117322907-117322929 GACCCCAGGGTAGGCCTTAGAGG - Intronic
1104754550 12:131260861-131260883 CTCCCCTGGAGATGCTTGAGGGG + Intergenic
1104967919 12:132517664-132517686 CACGCCACCAGAGGCCTGGGTGG - Intronic
1105337373 13:19486583-19486605 CACTCCAGGAGTGGCCTGAAGGG + Intronic
1105346629 13:19578835-19578857 CACCCCACAAGAGGCCCCAGTGG - Intergenic
1107014115 13:35695249-35695271 CAGCCCGGGAGGGGCCAGAGAGG - Intergenic
1108041574 13:46344173-46344195 CAACACTGGAGTGGCCTGAGAGG + Intronic
1108632645 13:52301986-52302008 CACTCCAGGAGTGGCCTGAAGGG + Intergenic
1108654054 13:52510607-52510629 CACTCCAGGAGTGGCCTGAAGGG - Intergenic
1112209645 13:97362980-97363002 CACCTCAGAAGATGCCTGATGGG - Intronic
1113848939 13:113407191-113407213 CACCCCAGGTGATGGCTCAGAGG - Intergenic
1116767727 14:49092510-49092532 CACTGAAGGAGAGTCCTGAGAGG + Intergenic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1118843333 14:69528389-69528411 CACCCCGGGAGAGTGCCGAGGGG - Exonic
1119685607 14:76628585-76628607 CACCCTAGGAGAGGCTGGTGGGG - Intergenic
1121718160 14:96090792-96090814 CACTTCAGGAGACGCCAGAGTGG - Exonic
1122234433 14:100323786-100323808 GACCCCAGGAGAGGATCGAGAGG + Intronic
1122706814 14:103627055-103627077 AGCCCCAGGAGAGGCCGGCGAGG - Intronic
1122996622 14:105268694-105268716 CACCCCAGGAGAGGCCCCCCAGG - Intronic
1124618922 15:31263078-31263100 GACCCCAGGAAAGTGCTGAGAGG - Intergenic
1124640308 15:31392609-31392631 ACCCCCAGGACAGGCCTGAGGGG - Intronic
1124643693 15:31419114-31419136 CCCCCCAGAAAAGGCTTGAGAGG + Intronic
1124880766 15:33640440-33640462 CACCCCAGGAATGGTCTGAGCGG + Intronic
1125482887 15:40092769-40092791 TTTCCCAGGAGAGGCCTGGGGGG + Intronic
1128212267 15:65910946-65910968 CCCCCAAGGACAGGTCTGAGAGG - Intronic
1128300701 15:66564825-66564847 CGCCCCAGGAGAAGCCTGCAGGG + Exonic
1129178226 15:73855273-73855295 CTCTCCAGGAGAGCCCTGAAGGG + Intergenic
1129459942 15:75695509-75695531 CACCCCAACAGAGGCCTCTGAGG + Intronic
1131188722 15:90295596-90295618 CGCACCAGGAGAGGCCAGGGAGG + Intronic
1131456327 15:92585233-92585255 CAGCCCCAGAGCGGCCTGAGTGG - Intergenic
1131518103 15:93092791-93092813 CACTCTAGGAGAGCCCTGATTGG + Intergenic
1132578819 16:675975-675997 GACCCCAGGAGAGGACTGACTGG + Intronic
1132684739 16:1157598-1157620 CTGCCCACGAGAGGCCTGCGGGG - Intronic
1132689849 16:1177570-1177592 CCCCCCAGGACAGGCTTGGGAGG + Intronic
1132894869 16:2223942-2223964 CCCCGCAGGAGAGGCCCGTGAGG - Intronic
1132971502 16:2691494-2691516 CACTCCGGGAGAGGGCTGTGGGG + Intronic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1136227282 16:28867389-28867411 CAGCCCTGGAGATGCCTGACCGG + Exonic
1136538578 16:30914959-30914981 AAGCCCAGGAGAGGCCTCATAGG - Intergenic
1137391537 16:48085368-48085390 CTCCCCAGGGGAAGCCTGGGAGG + Intronic
1138457754 16:57131182-57131204 CTCCCCATGAGAAGCCTGTGGGG + Intronic
1139546816 16:67653417-67653439 CACCCCAGGCCATGCCTGTGCGG + Intronic
1139708874 16:68761260-68761282 AGCCCTTGGAGAGGCCTGAGTGG + Intronic
1140092808 16:71851548-71851570 CCCCCCGAGAAAGGCCTGAGAGG + Exonic
1140406214 16:74713407-74713429 CGCCCGAGTAGGGGCCTGAGCGG + Exonic
1140857188 16:78988541-78988563 CTCCCCAGGAGAGGTCCCAGCGG + Intronic
1141702534 16:85649060-85649082 CAACCCAGGAGAGGCCTCTGGGG - Intronic
1142156030 16:88533266-88533288 CACCAACGGAGAGGCCAGAGCGG + Exonic
1142208070 16:88793391-88793413 CAACCCCAGAGAGGCGTGAGCGG - Intergenic
1142286382 16:89173180-89173202 CTCCCCGGCAGAGGGCTGAGGGG - Intronic
1143130676 17:4675078-4675100 CAGGCCAGGAGAGGCCTTACAGG - Exonic
1144772415 17:17767104-17767126 CACCCCAGCAAAGGGCTGTGGGG - Intronic
1144876001 17:18397574-18397596 CACTCCAGGAGGGGCTGGAGTGG + Intergenic
1145156227 17:20546846-20546868 CACTCCAGGAGGGGCTGGAGTGG - Intergenic
1146508253 17:33424048-33424070 TACCCCAGGAGATGCCTTGGGGG + Intronic
1146843699 17:36170932-36170954 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1146856006 17:36258866-36258888 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1146864614 17:36329509-36329531 CGCCCCAGGAGGGGCTGGAGCGG + Intronic
1146871912 17:36382777-36382799 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1146879273 17:36433862-36433884 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1146883203 17:36455007-36455029 CGCCCCAGGAGGGGCTGGAGCGG - Intergenic
1147067474 17:37930097-37930119 CGCCCCAGGAGGGGCTGGAGCGG + Intronic
1147074798 17:37983401-37983423 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1147079005 17:38009658-38009680 CGCCCCAGGAGGGGCTGGAGCGG + Intronic
1147086321 17:38062947-38062969 CGCCCCAGGAGGGGCTGGAGCGG - Intronic
1147094942 17:38133593-38133615 CGCCCCAGGAGGGGCTGGAGCGG + Intergenic
1147102267 17:38186910-38186932 CGCCCCAGGAGGGGCTGGAGCGG - Intergenic
1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG + Intronic
1149212794 17:54322906-54322928 CACTCCATGAGAGTCCTGAAAGG + Intergenic
1149846855 17:60013417-60013439 CGCCCCAGGAGGGGCTGGAGCGG - Intergenic
1149985111 17:61341321-61341343 CACCACAGGAGAGGACTCCGGGG + Intronic
1150085203 17:62269994-62270016 CGCCCCAGGAGGGGCTGGAGCGG - Intergenic
1150142088 17:62738814-62738836 AAACCCAGGAGGGGCCTGAGAGG - Intronic
1151227299 17:72656621-72656643 CTCCCCGGGAGAGGCCTGTCAGG - Intronic
1151559610 17:74863232-74863254 CGCTGCAGTAGAGGCCTGAGAGG + Exonic
1152084958 17:78212330-78212352 CACCCCAGCAGAGGCCATGGTGG + Intergenic
1152115706 17:78385817-78385839 GCCCCCATGAGAGGCCTCAGTGG - Intronic
1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG + Intronic
1152659294 17:81535007-81535029 CTACCCAGGAGAGGCGTGAGGGG + Intronic
1152934599 17:83128650-83128672 CTCCACAGGAGACTCCTGAGTGG - Intergenic
1153019094 18:610787-610809 CACACCTTGAGAGGCCTAAGTGG + Intronic
1154198273 18:12281745-12281767 CATCTCAGGGGAGGCCTGGGTGG - Intergenic
1155493363 18:26420830-26420852 CACGCCACGAGGGGGCTGAGCGG - Intergenic
1155877110 18:31101645-31101667 CACTCAAGGAGAGGCGGGAGCGG - Intronic
1157621379 18:49019094-49019116 CACCCCTGCCGTGGCCTGAGCGG - Intergenic
1157863894 18:51164928-51164950 AACCCCAGGGGAGAGCTGAGTGG + Intergenic
1158489280 18:57895324-57895346 CACCCACGGAGAAGCCTGAGGGG + Intergenic
1159003232 18:62991495-62991517 CTCCCCAGGAGAGACATTAGAGG - Intergenic
1159607239 18:70487660-70487682 CACCCCAGCAGTGGCCTCACGGG + Intergenic
1160658046 19:283659-283681 GAGCTCAGGAGAGGCCTGCGAGG + Intronic
1160849016 19:1180747-1180769 CACACCAGGAAGGGCCTGATTGG - Intronic
1161399243 19:4060144-4060166 CAGCCCAGGAGGGGCCTGCCAGG - Intronic
1162136313 19:8557600-8557622 GACCAAAGGAGAGGGCTGAGGGG - Intronic
1162389124 19:10378499-10378521 CACCCCAGCTAAGGCCTGAGGGG + Intronic
1162753188 19:12841154-12841176 CACCCGAGCTGGGGCCTGAGGGG + Intronic
1163623205 19:18372950-18372972 CATCCCAGGATATGGCTGAGAGG + Intergenic
1164896223 19:31879822-31879844 GATCCCAGCAGAGGACTGAGAGG + Intergenic
1166741956 19:45119863-45119885 CGCCCCAGGAGGGGCTTTAGGGG + Intronic
1166777555 19:45322181-45322203 CACCCCAGGAGAGGGCACTGAGG + Intronic
1167289579 19:48616952-48616974 GACCTGAGGAGAGGCCTGTGGGG - Intronic
1167424395 19:49422614-49422636 CCCCCCAGGACGGGCCTGGGCGG - Exonic
1167612588 19:50514580-50514602 CAGCCCAGGAGAAGCCTTCGAGG + Intronic
925951913 2:8922733-8922755 CAGCACAGAGGAGGCCTGAGAGG - Intronic
926086159 2:10021609-10021631 CACCACAGGAGAAGCCCCAGAGG - Intergenic
926175828 2:10591359-10591381 CACCCCAGGAGGGGCCCTGGGGG + Intronic
928194799 2:29207479-29207501 CAAACCACGAGAGGCATGAGAGG + Intronic
928438092 2:31268955-31268977 CCACCCAGGAGAGACCTGTGAGG + Exonic
932417051 2:71579922-71579944 CACCTTGGAAGAGGCCTGAGTGG + Intronic
932949857 2:76280338-76280360 CTCCCCAGTGGAGGCCTGATGGG - Intergenic
933352555 2:81173263-81173285 GAACACAGGAGAGGCCAGAGTGG + Intergenic
933704783 2:85281627-85281649 CACCCCATTTGAGGGCTGAGGGG + Intronic
933992886 2:87646467-87646489 CACTGCAGGAGAGCCCTCAGCGG - Intergenic
935854846 2:107262508-107262530 CAGCCCAGGAGAGACATGGGTGG + Intergenic
936300970 2:111304412-111304434 CACTGCAGGAGAGCCCTCAGCGG + Intergenic
937203667 2:120222739-120222761 CACCGAGGGAGAGGCCTGTGTGG - Exonic
938318011 2:130343153-130343175 CAGCCCAGGAGAGGAAGGAGCGG + Exonic
938702582 2:133892819-133892841 CACCCCATGACAACCCTGAGGGG - Intergenic
940238846 2:151541399-151541421 CACCCCCTGTGATGCCTGAGTGG + Intronic
946166380 2:217866687-217866709 CCCCAGTGGAGAGGCCTGAGAGG - Intronic
946195428 2:218030039-218030061 CAGCCAGGGAGAGGGCTGAGTGG - Intergenic
947582519 2:231330469-231330491 CACCCCAGGAAGGGTGTGAGGGG + Intronic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
947744605 2:232501070-232501092 AACCCCATGACAGCCCTGAGAGG - Intergenic
948661426 2:239508923-239508945 CAGCCCAGGAGAGGCCAGGGAGG - Intergenic
948693638 2:239721976-239721998 CACTCCAGAAAGGGCCTGAGAGG + Intergenic
1169195665 20:3680983-3681005 GACCCCAGGATAGGGCTCAGAGG + Intronic
1169702603 20:8464861-8464883 AACCCCAGCTGAGGGCTGAGGGG - Intronic
1170781274 20:19427684-19427706 CAGCCCAGGACAGGCCTGGGAGG - Intronic
1171466153 20:25329238-25329260 CCCCACAGGAGTGGCCTGGGCGG + Intronic
1172479036 20:35260221-35260243 AAACCCAAGAGAGCCCTGAGGGG - Intronic
1173070238 20:39757324-39757346 CAGCAAAGGAGAGGACTGAGTGG + Intergenic
1173852693 20:46228752-46228774 CAGCCCAGGAGGGGCCTGCCTGG - Intronic
1173947190 20:46960937-46960959 CATCCCAGGAGGTGCCTGGGAGG + Intronic
1174054226 20:47786711-47786733 CGCCACAGAAGAGGCCGGAGGGG + Intergenic
1174387701 20:50197140-50197162 AGACCCAGGAGAGGCCAGAGTGG + Intergenic
1174556717 20:51400749-51400771 CACCCCCGGAGATGTCTGTGAGG - Intronic
1175283345 20:57820141-57820163 CATCCCATGGGAGGCCTGGGAGG + Intergenic
1175636808 20:60591328-60591350 CTCCCCAGGAGGTGCCTGCGTGG + Intergenic
1176049823 20:63112841-63112863 CACAGAAGGAGAGGCCCGAGAGG + Intergenic
1176736195 21:10548792-10548814 CACTCCAGGAGTGGCCTGAAGGG - Intronic
1178690034 21:34743043-34743065 CCCCCCAGGAGGGGCTGGAGCGG + Intergenic
1179603538 21:42496774-42496796 CATCCCCGGAGGGGCCTGCGAGG - Intronic
1179830653 21:43994117-43994139 CCCCCCAGGAAATTCCTGAGAGG + Intergenic
1180350191 22:11794453-11794475 CACCCCAGGGGAGTCCTGGTTGG + Intergenic
1180902862 22:19387117-19387139 CACCCCAGCAGAGCACAGAGGGG + Intronic
1183176944 22:36231275-36231297 CAGCCCAGGGGAGATCTGAGTGG + Intronic
1183532950 22:38374062-38374084 CACTCCAGGAGTGGCCTGAAGGG + Intronic
1183680979 22:39329045-39329067 CAGCCCAGTAAAGGCCTAAGTGG - Intergenic
1184644689 22:45889547-45889569 ACCCCCAGAGGAGGCCTGAGAGG - Intergenic
1184742899 22:46439397-46439419 CCCCCCAGGAGAGCACTGTGAGG - Exonic
1184856351 22:47148719-47148741 GACCCCAGGAGAGGACCCAGGGG - Intronic
1185294443 22:50046324-50046346 GACCCCAGGAGAGGGAGGAGCGG + Intronic
949504546 3:4714609-4714631 CACCTCAGGAGAGGCTGGAGAGG - Intronic
953906830 3:46872578-46872600 CAGGCGAGGAGGGGCCTGAGAGG - Intronic
953993501 3:47501919-47501941 CACGACAGGAGAGGGCTAAGGGG + Intronic
954435549 3:50493980-50494002 CAGCCCAGGCAAGGCCTCAGGGG + Intronic
954453807 3:50586169-50586191 CACCTCAGGAGGGCCCTGGGGGG - Intergenic
954772803 3:52988072-52988094 CAACCCAGAAGAGAGCTGAGGGG + Intronic
955742149 3:62102706-62102728 GACCCCTGGAGAGGTCTGAGAGG + Intronic
956255805 3:67282236-67282258 CACCCCACGACAGGCCCCAGTGG - Intergenic
959981714 3:112524945-112524967 CAGCCCAGGAGAGGTTGGAGAGG + Intergenic
961361104 3:126367609-126367631 CACACAAGGAGGGGCCTCAGAGG + Intergenic
961482987 3:127196047-127196069 CACTCCAGGAGAAACCTGACAGG + Intronic
962357622 3:134708454-134708476 CAAGCCTGGAGAGGCCTGACAGG - Intronic
962829532 3:139127957-139127979 CTCCCCAGGAGTCACCTGAGAGG - Intronic
964666283 3:159177525-159177547 CACCTCAGGAAATACCTGAGTGG - Intronic
968481367 4:834566-834588 CCCCCCGGGTGAGGCCTGGGTGG + Intergenic
968845780 4:3040940-3040962 CACCCAGGGAGAGGCCAGCGGGG + Intergenic
968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG + Intergenic
969476510 4:7425259-7425281 GACCCCAGGACTGGCCTGTGTGG + Intronic
969705233 4:8788177-8788199 CTCCCCAGGAGAGGGCTGCTGGG + Intergenic
974507252 4:62791587-62791609 CACCCCAGATGAGGACTGACTGG + Intergenic
982157266 4:152535383-152535405 GACCCCCGGAGGGGGCTGAGGGG + Exonic
985543685 5:498794-498816 CACCCCAGGAGAGGCAGCCGAGG - Intronic
985655698 5:1130460-1130482 CACCCCAGGAGAGGCCACCTGGG + Intergenic
985905656 5:2833848-2833870 TAACCCAGGAAAGGCCTCAGAGG + Intergenic
986132376 5:4943123-4943145 AAAGCCAGGAGAGGCCAGAGAGG + Intergenic
987906044 5:24078614-24078636 CAAACCAAGAGAGGCCTAAGAGG + Intronic
990229767 5:53700345-53700367 CACCCCATGACAGGCCCCAGTGG + Intergenic
995555998 5:113329292-113329314 CACCCAACTAGAGGCCTGGGTGG - Intronic
996416438 5:123215910-123215932 TGCCCAAGGAGAGGTCTGAGAGG + Intergenic
997243769 5:132328628-132328650 CACCCCAGCACAGCCCTGAAGGG - Intronic
1001226393 5:169948004-169948026 CCCCAGAGGAAAGGCCTGAGAGG - Intronic
1001315969 5:170641557-170641579 CACCCCAGCAGAGGGTTGAGAGG - Intronic
1002183112 5:177441621-177441643 CAGGCCAGGAGCTGCCTGAGGGG - Intronic
1003308536 6:4949242-4949264 CACCCCAGCAGGCCCCTGAGAGG - Intronic
1003436177 6:6090689-6090711 CACTCCAGGAGAGCCCTAACTGG + Intergenic
1003673345 6:8180340-8180362 TACCCCAGGAGAGGGGCGAGGGG + Intergenic
1006439069 6:34042112-34042134 AACATCAGGAGAGGCCTGATGGG + Intronic
1006910720 6:37561783-37561805 CAGCCCAGCCCAGGCCTGAGTGG + Intergenic
1006910929 6:37563227-37563249 CAGCCCAGCCCAGGCCTGAGTGG - Intergenic
1007285031 6:40741444-40741466 CACAGCAGGAGTGGCCTGGGAGG + Intergenic
1007725156 6:43911607-43911629 CACTCAAGGAAATGCCTGAGCGG - Intergenic
1007745973 6:44043107-44043129 CACCCCCAGGGAGGCCTGAAGGG - Intergenic
1013056368 6:106587070-106587092 AATCCCAGCAGAGGCATGAGTGG + Intronic
1016943462 6:149504351-149504373 AGCCCCAGGAGAAGCATGAGAGG + Intergenic
1019340702 7:507541-507563 CACCCCATGACAGGCCAGGGTGG + Intronic
1019441760 7:1051001-1051023 CAGGCCAGCAGAGGCCTGGGTGG + Intronic
1019485061 7:1285589-1285611 CACCCTCGGCGAAGCCTGAGGGG - Intergenic
1019558656 7:1645168-1645190 CACCCCAGGACACCCCTGGGTGG + Intergenic
1019937259 7:4264764-4264786 CACCCCAGGAGAGGTCTACACGG - Intronic
1021652065 7:22842161-22842183 GACCCCAGCAGAGGCCAGTGAGG + Intergenic
1023455457 7:40333909-40333931 CACCCCACGACAGGCCTCAGTGG + Intronic
1023518327 7:41025971-41025993 GACTCCAGGAGAGGCCTTGGAGG + Intergenic
1025236991 7:57241193-57241215 CAACCCAGGAGAAGCCTGTATGG + Intergenic
1027221891 7:76219482-76219504 CAGCCCAGCAGAAGCCTGAGGGG + Intronic
1030281581 7:107781504-107781526 CACCCGGGGAGAAGCATGAGAGG + Intronic
1030779014 7:113574115-113574137 CACCCCATGACAGGCCCCAGTGG - Intergenic
1031141296 7:117946443-117946465 CTCCCAAGGTGAGGCCTGAATGG - Intergenic
1031268361 7:119611644-119611666 CACTCTAGGAGAGGCCTGACAGG - Intergenic
1034530008 7:151689712-151689734 AACCCCAGGAGAGCCCTGGTTGG - Intronic
1034939292 7:155220096-155220118 GATGCCAGGAGAGGGCTGAGTGG + Intergenic
1035486799 7:159232488-159232510 CACCCAGGGAGAGGCTTGACGGG + Intergenic
1036200925 8:6771210-6771232 CACCCCATGGGAGGCCACAGGGG - Intergenic
1037949686 8:23010758-23010780 TCCCCCAGGAGAGACGTGAGAGG - Intronic
1038018354 8:23533181-23533203 CTCCTCAGGGTAGGCCTGAGGGG - Intronic
1038583205 8:28768062-28768084 CACCTGAGGAGTGGCATGAGAGG - Exonic
1040336484 8:46418656-46418678 CCGCCCAGGACAGCCCTGAGGGG - Intergenic
1040905908 8:52469793-52469815 AACCCCTGGAGGGTCCTGAGTGG - Intergenic
1041023559 8:53661246-53661268 GACTCCAGGGGAGACCTGAGAGG + Intergenic
1044605323 8:94042887-94042909 GACCCCAGGAGTGGCTTGGGGGG - Intergenic
1046704945 8:117439300-117439322 AAGCCAAGGAGAGGCCTCAGAGG + Intergenic
1047186139 8:122635045-122635067 CACCCCAGGAGAACCCTGCCTGG + Intergenic
1048333738 8:133488615-133488637 CTCCCCTGGAGAGCCCTGACTGG + Intronic
1048893320 8:138966788-138966810 CATCCCAGGTGAGGCATGAGTGG - Intergenic
1049213511 8:141397389-141397411 CAACCCAGGACAGGCCTTACAGG - Intronic
1049288917 8:141791386-141791408 CACCACAGCAGAGGCCTTGGGGG + Intergenic
1049494341 8:142922678-142922700 CACACCAGCCGAGGCCAGAGTGG + Intergenic
1053144713 9:35704575-35704597 GACAACAGGAGAGGGCTGAGAGG + Intronic
1056109520 9:83381038-83381060 TTCCCCAGAAGAGGCCAGAGGGG - Intronic
1056678622 9:88697661-88697683 CACCCCTTGCGAGGCCTGTGGGG + Intergenic
1056796633 9:89663179-89663201 CACCCCAGGTGACACCTCAGGGG - Intergenic
1057888934 9:98853298-98853320 CTCTCCAGGAGAGCCCTGACGGG + Intergenic
1057954473 9:99396591-99396613 CACCCCAGGAGAGTGCGAAGTGG + Intergenic
1058085372 9:100742636-100742658 CACCCCACGACAGGCCACAGTGG + Intergenic
1058161815 9:101578492-101578514 CACCACAGGAGAGGCCAGGATGG + Intronic
1059025734 9:110626743-110626765 CTCCCTAGGAGAGCCCTGATAGG - Intergenic
1060033600 9:120236135-120236157 CACACCAGGAGAGGCCCATGTGG + Intergenic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1060943748 9:127557991-127558013 GACCCCAGGAGAGTCCTAGGGGG + Intronic
1061281737 9:129601527-129601549 AACCCCAGGAGAGTCCTGACTGG + Intergenic
1061615263 9:131774969-131774991 CTCCCCAGGAGAAGCCAGGGTGG - Intergenic
1061727279 9:132588807-132588829 TCACCCTGGAGAGGCCTGAGGGG - Intronic
1061814963 9:133189006-133189028 CAGCACAGGAGATGGCTGAGAGG + Intergenic
1062106142 9:134756077-134756099 CACCACAGGAGAGCCCTGCAAGG - Intronic
1062265213 9:135683760-135683782 CACCCCAGGCCAGCCCTGAGGGG + Intergenic
1062526905 9:136981571-136981593 CAGCCCTGGGGAGTCCTGAGGGG - Exonic
1062567684 9:137170522-137170544 TATCCCAGGAGAGTCCTGGGGGG - Intronic
1185562369 X:1069590-1069612 GACCCCAGGATGGGGCTGAGAGG + Intergenic
1185769974 X:2758391-2758413 CACCCCAGGTGATGCCCAAGCGG + Intronic
1200077045 X:153556429-153556451 CACCCCAGGAAAGGGGTGTGGGG - Intronic
1200239741 X:154487162-154487184 CACCCCCGGGGAGGGCTGATAGG + Intergenic
1201300548 Y:12501241-12501263 CACCCCAGGTGATGCCCAAGCGG - Intergenic
1202594490 Y:26521956-26521978 CACTCCAGGAGTGGCCTGAAGGG - Intergenic