ID: 1094806614

View in Genome Browser
Species Human (GRCh38)
Location 12:34100385-34100407
Sequence AGCTGGGTATAGAGGGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094806614_1094806622 28 Left 1094806614 12:34100385-34100407 CCGTTTTCCCTCTATACCCAGCT No data
Right 1094806622 12:34100436-34100458 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1094806614_1094806621 17 Left 1094806614 12:34100385-34100407 CCGTTTTCCCTCTATACCCAGCT No data
Right 1094806621 12:34100425-34100447 TCTGCTTTCTCAAATACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094806614 Original CRISPR AGCTGGGTATAGAGGGAAAA CGG (reversed) Intergenic
No off target data available for this crispr