ID: 1094809545

View in Genome Browser
Species Human (GRCh38)
Location 12:34124135-34124157
Sequence CCAGACCTACACAATATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094809545_1094809549 -6 Left 1094809545 12:34124135-34124157 CCCTACATATTGTGTAGGTCTGG No data
Right 1094809549 12:34124152-34124174 GTCTGGCTCTGGCAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094809545 Original CRISPR CCAGACCTACACAATATGTA GGG (reversed) Intergenic
No off target data available for this crispr