ID: 1094811510

View in Genome Browser
Species Human (GRCh38)
Location 12:34142946-34142968
Sequence TCCAGCTGGCCAGCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094811505_1094811510 16 Left 1094811505 12:34142907-34142929 CCACAGCACGTCACAAGTTAAGA No data
Right 1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG No data
1094811503_1094811510 22 Left 1094811503 12:34142901-34142923 CCACTCCCACAGCACGTCACAAG No data
Right 1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG No data
1094811501_1094811510 24 Left 1094811501 12:34142899-34142921 CCCCACTCCCACAGCACGTCACA No data
Right 1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG No data
1094811507_1094811510 -7 Left 1094811507 12:34142930-34142952 CCCATTGGCTTAGAATTCCAGCT No data
Right 1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG No data
1094811508_1094811510 -8 Left 1094811508 12:34142931-34142953 CCATTGGCTTAGAATTCCAGCTG No data
Right 1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG No data
1094811502_1094811510 23 Left 1094811502 12:34142900-34142922 CCCACTCCCACAGCACGTCACAA No data
Right 1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG No data
1094811504_1094811510 17 Left 1094811504 12:34142906-34142928 CCCACAGCACGTCACAAGTTAAG No data
Right 1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094811510 Original CRISPR TCCAGCTGGCCAGCAGCAGC AGG Intergenic
No off target data available for this crispr