ID: 1094812385

View in Genome Browser
Species Human (GRCh38)
Location 12:34151246-34151268
Sequence ACTTCCAAGCACACTCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094812385_1094812389 28 Left 1094812385 12:34151246-34151268 CCACAATGAGTGTGCTTGGAAGT No data
Right 1094812389 12:34151297-34151319 AGAACACAGCCCCAGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094812385 Original CRISPR ACTTCCAAGCACACTCATTG TGG (reversed) Intergenic
No off target data available for this crispr