ID: 1094813005

View in Genome Browser
Species Human (GRCh38)
Location 12:34160178-34160200
Sequence CCAAATTCACAAATGGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094813005_1094813009 1 Left 1094813005 12:34160178-34160200 CCCTTGTCCATTTGTGAATTTGG No data
Right 1094813009 12:34160202-34160224 TGCTCATCTTTTAATAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094813005 Original CRISPR CCAAATTCACAAATGGACAA GGG (reversed) Intergenic
No off target data available for this crispr