ID: 1094813709

View in Genome Browser
Species Human (GRCh38)
Location 12:34164655-34164677
Sequence AAAATGCAGCAGGAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094813705_1094813709 -1 Left 1094813705 12:34164633-34164655 CCGCATACTATAAAAGTGCTTCA No data
Right 1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094813709 Original CRISPR AAAATGCAGCAGGAGGAGAT GGG Intergenic
No off target data available for this crispr