ID: 1094813783

View in Genome Browser
Species Human (GRCh38)
Location 12:34165196-34165218
Sequence GTTTGATGCTAAGAATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094813783_1094813788 8 Left 1094813783 12:34165196-34165218 CCATCATATTCTTAGCATCAAAC No data
Right 1094813788 12:34165227-34165249 GGTAAGGTAAGCTCAGCCACGGG No data
1094813783_1094813792 27 Left 1094813783 12:34165196-34165218 CCATCATATTCTTAGCATCAAAC No data
Right 1094813792 12:34165246-34165268 CGGGCAGGGCCCTGTACTGCTGG No data
1094813783_1094813787 7 Left 1094813783 12:34165196-34165218 CCATCATATTCTTAGCATCAAAC No data
Right 1094813787 12:34165226-34165248 GGGTAAGGTAAGCTCAGCCACGG No data
1094813783_1094813790 13 Left 1094813783 12:34165196-34165218 CCATCATATTCTTAGCATCAAAC No data
Right 1094813790 12:34165232-34165254 GGTAAGCTCAGCCACGGGCAGGG No data
1094813783_1094813786 -8 Left 1094813783 12:34165196-34165218 CCATCATATTCTTAGCATCAAAC No data
Right 1094813786 12:34165211-34165233 CATCAAACATCTGCTGGGTAAGG No data
1094813783_1094813789 12 Left 1094813783 12:34165196-34165218 CCATCATATTCTTAGCATCAAAC No data
Right 1094813789 12:34165231-34165253 AGGTAAGCTCAGCCACGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094813783 Original CRISPR GTTTGATGCTAAGAATATGA TGG (reversed) Intergenic
No off target data available for this crispr