ID: 1094813790

View in Genome Browser
Species Human (GRCh38)
Location 12:34165232-34165254
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094813783_1094813790 13 Left 1094813783 12:34165196-34165218 CCATCATATTCTTAGCATCAAAC No data
Right 1094813790 12:34165232-34165254 GGTAAGCTCAGCCACGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094813790 Original CRISPR GGTAAGCTCAGCCACGGGCA GGG Intergenic
No off target data available for this crispr