ID: 1094814673

View in Genome Browser
Species Human (GRCh38)
Location 12:34171245-34171267
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094814673_1094814679 6 Left 1094814673 12:34171245-34171267 CCCAGAGGCCCTGGAGGACAACT No data
Right 1094814679 12:34171274-34171296 ATAAGAAAGGCAGTGTTTTTGGG No data
1094814673_1094814677 -7 Left 1094814673 12:34171245-34171267 CCCAGAGGCCCTGGAGGACAACT No data
Right 1094814677 12:34171261-34171283 GACAACTTAGAAGATAAGAAAGG No data
1094814673_1094814678 5 Left 1094814673 12:34171245-34171267 CCCAGAGGCCCTGGAGGACAACT No data
Right 1094814678 12:34171273-34171295 GATAAGAAAGGCAGTGTTTTTGG No data
1094814673_1094814680 29 Left 1094814673 12:34171245-34171267 CCCAGAGGCCCTGGAGGACAACT No data
Right 1094814680 12:34171297-34171319 CTTGTCCATCATGAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094814673 Original CRISPR AGTTGTCCTCCAGGGCCTCT GGG (reversed) Intergenic