ID: 1094814675

View in Genome Browser
Species Human (GRCh38)
Location 12:34171253-34171275
Sequence ATCTTCTAAGTTGTCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094814675_1094814678 -3 Left 1094814675 12:34171253-34171275 CCCTGGAGGACAACTTAGAAGAT No data
Right 1094814678 12:34171273-34171295 GATAAGAAAGGCAGTGTTTTTGG No data
1094814675_1094814679 -2 Left 1094814675 12:34171253-34171275 CCCTGGAGGACAACTTAGAAGAT No data
Right 1094814679 12:34171274-34171296 ATAAGAAAGGCAGTGTTTTTGGG No data
1094814675_1094814680 21 Left 1094814675 12:34171253-34171275 CCCTGGAGGACAACTTAGAAGAT No data
Right 1094814680 12:34171297-34171319 CTTGTCCATCATGAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094814675 Original CRISPR ATCTTCTAAGTTGTCCTCCA GGG (reversed) Intergenic