ID: 1094814677

View in Genome Browser
Species Human (GRCh38)
Location 12:34171261-34171283
Sequence GACAACTTAGAAGATAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094814673_1094814677 -7 Left 1094814673 12:34171245-34171267 CCCAGAGGCCCTGGAGGACAACT No data
Right 1094814677 12:34171261-34171283 GACAACTTAGAAGATAAGAAAGG No data
1094814674_1094814677 -8 Left 1094814674 12:34171246-34171268 CCAGAGGCCCTGGAGGACAACTT No data
Right 1094814677 12:34171261-34171283 GACAACTTAGAAGATAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094814677 Original CRISPR GACAACTTAGAAGATAAGAA AGG Intergenic