ID: 1094814678

View in Genome Browser
Species Human (GRCh38)
Location 12:34171273-34171295
Sequence GATAAGAAAGGCAGTGTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094814676_1094814678 -4 Left 1094814676 12:34171254-34171276 CCTGGAGGACAACTTAGAAGATA No data
Right 1094814678 12:34171273-34171295 GATAAGAAAGGCAGTGTTTTTGG No data
1094814673_1094814678 5 Left 1094814673 12:34171245-34171267 CCCAGAGGCCCTGGAGGACAACT No data
Right 1094814678 12:34171273-34171295 GATAAGAAAGGCAGTGTTTTTGG No data
1094814675_1094814678 -3 Left 1094814675 12:34171253-34171275 CCCTGGAGGACAACTTAGAAGAT No data
Right 1094814678 12:34171273-34171295 GATAAGAAAGGCAGTGTTTTTGG No data
1094814674_1094814678 4 Left 1094814674 12:34171246-34171268 CCAGAGGCCCTGGAGGACAACTT No data
Right 1094814678 12:34171273-34171295 GATAAGAAAGGCAGTGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094814678 Original CRISPR GATAAGAAAGGCAGTGTTTT TGG Intergenic