ID: 1094814680

View in Genome Browser
Species Human (GRCh38)
Location 12:34171297-34171319
Sequence CTTGTCCATCATGAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094814675_1094814680 21 Left 1094814675 12:34171253-34171275 CCCTGGAGGACAACTTAGAAGAT No data
Right 1094814680 12:34171297-34171319 CTTGTCCATCATGAGAAGACAGG No data
1094814673_1094814680 29 Left 1094814673 12:34171245-34171267 CCCAGAGGCCCTGGAGGACAACT No data
Right 1094814680 12:34171297-34171319 CTTGTCCATCATGAGAAGACAGG No data
1094814674_1094814680 28 Left 1094814674 12:34171246-34171268 CCAGAGGCCCTGGAGGACAACTT No data
Right 1094814680 12:34171297-34171319 CTTGTCCATCATGAGAAGACAGG No data
1094814676_1094814680 20 Left 1094814676 12:34171254-34171276 CCTGGAGGACAACTTAGAAGATA No data
Right 1094814680 12:34171297-34171319 CTTGTCCATCATGAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094814680 Original CRISPR CTTGTCCATCATGAGAAGAC AGG Intergenic