ID: 1094816117

View in Genome Browser
Species Human (GRCh38)
Location 12:34186491-34186513
Sequence CTGAGCCAGTCGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094816117_1094816120 24 Left 1094816117 12:34186491-34186513 CCTTCCACATTCGACTGGCTCAG No data
Right 1094816120 12:34186538-34186560 CCTAATAATTGAAGTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094816117 Original CRISPR CTGAGCCAGTCGAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr