ID: 1094817600

View in Genome Browser
Species Human (GRCh38)
Location 12:34203428-34203450
Sequence AGGGATTCCAAAAGCTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094817600_1094817606 12 Left 1094817600 12:34203428-34203450 CCAAGCAAGCTTTTGGAATCCCT No data
Right 1094817606 12:34203463-34203485 TGATTCTTGGTTGGCATGTATGG No data
1094817600_1094817608 24 Left 1094817600 12:34203428-34203450 CCAAGCAAGCTTTTGGAATCCCT No data
Right 1094817608 12:34203475-34203497 GGCATGTATGGACCTGCCCAGGG No data
1094817600_1094817605 3 Left 1094817600 12:34203428-34203450 CCAAGCAAGCTTTTGGAATCCCT No data
Right 1094817605 12:34203454-34203476 TCTAGGACTTGATTCTTGGTTGG No data
1094817600_1094817607 23 Left 1094817600 12:34203428-34203450 CCAAGCAAGCTTTTGGAATCCCT No data
Right 1094817607 12:34203474-34203496 TGGCATGTATGGACCTGCCCAGG No data
1094817600_1094817604 -1 Left 1094817600 12:34203428-34203450 CCAAGCAAGCTTTTGGAATCCCT No data
Right 1094817604 12:34203450-34203472 TGATTCTAGGACTTGATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094817600 Original CRISPR AGGGATTCCAAAAGCTTGCT TGG (reversed) Intergenic
No off target data available for this crispr