ID: 1094817602

View in Genome Browser
Species Human (GRCh38)
Location 12:34203447-34203469
Sequence AGAATCAAGTCCTAGAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094817602_1094817608 5 Left 1094817602 12:34203447-34203469 CCCTGATTCTAGGACTTGATTCT No data
Right 1094817608 12:34203475-34203497 GGCATGTATGGACCTGCCCAGGG No data
1094817602_1094817609 14 Left 1094817602 12:34203447-34203469 CCCTGATTCTAGGACTTGATTCT No data
Right 1094817609 12:34203484-34203506 GGACCTGCCCAGGGCCAGTGAGG No data
1094817602_1094817607 4 Left 1094817602 12:34203447-34203469 CCCTGATTCTAGGACTTGATTCT No data
Right 1094817607 12:34203474-34203496 TGGCATGTATGGACCTGCCCAGG No data
1094817602_1094817606 -7 Left 1094817602 12:34203447-34203469 CCCTGATTCTAGGACTTGATTCT No data
Right 1094817606 12:34203463-34203485 TGATTCTTGGTTGGCATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094817602 Original CRISPR AGAATCAAGTCCTAGAATCA GGG (reversed) Intergenic
No off target data available for this crispr