ID: 1094817603

View in Genome Browser
Species Human (GRCh38)
Location 12:34203448-34203470
Sequence AAGAATCAAGTCCTAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094817603_1094817606 -8 Left 1094817603 12:34203448-34203470 CCTGATTCTAGGACTTGATTCTT No data
Right 1094817606 12:34203463-34203485 TGATTCTTGGTTGGCATGTATGG No data
1094817603_1094817609 13 Left 1094817603 12:34203448-34203470 CCTGATTCTAGGACTTGATTCTT No data
Right 1094817609 12:34203484-34203506 GGACCTGCCCAGGGCCAGTGAGG No data
1094817603_1094817607 3 Left 1094817603 12:34203448-34203470 CCTGATTCTAGGACTTGATTCTT No data
Right 1094817607 12:34203474-34203496 TGGCATGTATGGACCTGCCCAGG No data
1094817603_1094817608 4 Left 1094817603 12:34203448-34203470 CCTGATTCTAGGACTTGATTCTT No data
Right 1094817608 12:34203475-34203497 GGCATGTATGGACCTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094817603 Original CRISPR AAGAATCAAGTCCTAGAATC AGG (reversed) Intergenic
No off target data available for this crispr