ID: 1094817608

View in Genome Browser
Species Human (GRCh38)
Location 12:34203475-34203497
Sequence GGCATGTATGGACCTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094817600_1094817608 24 Left 1094817600 12:34203428-34203450 CCAAGCAAGCTTTTGGAATCCCT No data
Right 1094817608 12:34203475-34203497 GGCATGTATGGACCTGCCCAGGG No data
1094817602_1094817608 5 Left 1094817602 12:34203447-34203469 CCCTGATTCTAGGACTTGATTCT No data
Right 1094817608 12:34203475-34203497 GGCATGTATGGACCTGCCCAGGG No data
1094817603_1094817608 4 Left 1094817603 12:34203448-34203470 CCTGATTCTAGGACTTGATTCTT No data
Right 1094817608 12:34203475-34203497 GGCATGTATGGACCTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094817608 Original CRISPR GGCATGTATGGACCTGCCCA GGG Intergenic
No off target data available for this crispr