ID: 1094818715

View in Genome Browser
Species Human (GRCh38)
Location 12:34209052-34209074
Sequence GGCTCACGAGAGCACCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 37, 3: 16, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094818709_1094818715 16 Left 1094818709 12:34209013-34209035 CCTGGCTGGGCTGGAGCAGGGCA 0: 1
1: 0
2: 10
3: 131
4: 1322
Right 1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG 0: 1
1: 0
2: 37
3: 16
4: 85
1094818705_1094818715 25 Left 1094818705 12:34209004-34209026 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG 0: 1
1: 0
2: 37
3: 16
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094818715 Original CRISPR GGCTCACGAGAGCACCCTGT GGG Intergenic
903222218 1:21875310-21875332 GACTCTCCAGAGCTCCCTGTGGG + Intronic
904577140 1:31512193-31512215 GGCTCACGTGATCCTCCTGTTGG - Intergenic
910192016 1:84604459-84604481 GGATCACGAAATCCCCCTGTCGG - Intergenic
912385186 1:109267997-109268019 GGCCCACGAGAGCACCCAGCGGG + Exonic
913236286 1:116785866-116785888 GCATCAAGGGAGCACCCTGTGGG + Intergenic
915008134 1:152659590-152659612 GGCTCTCGACAGAACCATGTGGG - Intergenic
920436863 1:205952591-205952613 GGATCAGGAAAGAACCCTGTGGG + Intergenic
922085663 1:222344566-222344588 GGCTGGTGAGAGCTCCCTGTGGG - Intergenic
923069483 1:230549523-230549545 GGCTCAGAAGAGGACCCTGATGG + Intergenic
1063231034 10:4065739-4065761 TGCTCATGACAGCAGCCTGTGGG - Intergenic
1067168075 10:43881418-43881440 CACTCACCATAGCACCCTGTGGG - Intergenic
1070145426 10:73770408-73770430 GGCTCTGGACAACACCCTGTTGG - Exonic
1072804983 10:98418520-98418542 CGCTCAGGAGGGCACCCTGCAGG + Intronic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077485328 11:2835889-2835911 GGGTCAGCAGAGCACCGTGTGGG + Intronic
1081805566 11:45888126-45888148 GGCTGAGGAGAGCCGCCTGTAGG + Intronic
1091589734 12:1836114-1836136 GGCTCCCTAGAGCACCCAGCCGG + Exonic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG + Intergenic
1100937138 12:99681648-99681670 ACATCAAGAGAGCACCCTGTGGG + Intronic
1103401020 12:120642551-120642573 GGCTAACGAGGGCTCCCTGCAGG - Intronic
1106142300 13:27021458-27021480 GGTTCCCAAGAGCACCCTGCTGG + Intergenic
1109077684 13:57858590-57858612 GGCTCATGATGTCACCCTGTGGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1119472641 14:74909366-74909388 GGCTCCTGGGAGTACCCTGTGGG - Intronic
1121436717 14:93925476-93925498 GGCTGAAGAGAGCGCCCTGAGGG - Intronic
1122799054 14:104220820-104220842 GGCCCACGACAGCTCCCTCTCGG - Intergenic
1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202849684 14_GL000225v1_random:8991-9013 GGCTCACGAAATCCCCCAGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1127994482 15:64145160-64145182 GGGTCATGAGTGCACCCTGCAGG - Intronic
1129360897 15:75023527-75023549 GCCTCACGAGAGCACCGGGCTGG - Intergenic
1130784629 15:87082662-87082684 TGCTCTGGAGAGCTCCCTGTAGG - Intergenic
1131284062 15:91043181-91043203 GGATCAGGAGAGGACCCTGGAGG - Intergenic
1134691884 16:16196463-16196485 GGCACACAACTGCACCCTGTAGG - Intronic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1141509728 16:84504641-84504663 GGCTCTCGAGAGGAGCCCGTGGG - Exonic
1141569859 16:84928027-84928049 GGATGGCGAGGGCACCCTGTGGG - Intergenic
1144271341 17:13619689-13619711 GCCACACGAGGGCACACTGTGGG - Intergenic
1148549672 17:48543142-48543164 GGCTGTCGAGAGAACCCTGTAGG + Exonic
1157149958 18:45206794-45206816 GGATCAAGTCAGCACCCTGTAGG - Intergenic
1162801977 19:13116337-13116359 GGCTCTAGAGAGCACCCGGGCGG + Exonic
1164632279 19:29769449-29769471 AGCTCACAAGTGCACCCTGGGGG - Intergenic
925035811 2:684800-684822 AGCTCACGAGACCACCATGGAGG - Intergenic
937242056 2:120468205-120468227 GTCTCCCAGGAGCACCCTGTTGG + Intergenic
947843890 2:233228307-233228329 GGCTCACCCGAGAACCCTCTGGG - Intronic
947918427 2:233849446-233849468 GGTTCACAACACCACCCTGTAGG + Intronic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1173923190 20:46761331-46761353 GTCTCCCAAGAGCAGCCTGTTGG + Intergenic
1176030707 20:63009856-63009878 GGCCCGAGTGAGCACCCTGTGGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1183056025 22:35306348-35306370 GGCTCACATGGGCACACTGTGGG - Intronic
1184871844 22:47245663-47245685 GGGTCAGGAGAGCACCGTTTGGG - Intergenic
1185275187 22:49947655-49947677 GCCTCCCGAGCCCACCCTGTAGG - Intergenic
950754428 3:15161456-15161478 GGAGCAGGAGATCACCCTGTAGG - Intergenic
952703312 3:36349183-36349205 ACATCAAGAGAGCACCCTGTGGG + Intergenic
953276808 3:41508782-41508804 ACATCAAGAGAGCACCCTGTGGG + Intronic
954110942 3:48432667-48432689 GGCTTACGAGAGCAGCTTGATGG - Exonic
954395293 3:50290263-50290285 GGCTCTCAAGAGCACCCTGCCGG + Exonic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961795482 3:129405839-129405861 GGCACACAGGAGCATCCTGTGGG - Intronic
968577534 4:1374885-1374907 GGACCATGTGAGCACCCTGTGGG + Intronic
969056963 4:4408141-4408163 GGCTCAGGAGGGCACTCTGCTGG + Intronic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
974359356 4:60856260-60856282 GGCTCACCAGAGCAACCAGAGGG + Intergenic
978916175 4:114128033-114128055 ACATCAAGAGAGCACCCTGTGGG + Intergenic
982360892 4:154517978-154518000 AGCACAGGAGAGCACCCCGTGGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985536359 5:467715-467737 GGATCAGGAGGGCACCCTCTAGG - Intronic
985574835 5:669259-669281 GGCTCACCAGCGCCCCCTGGGGG - Intronic
1001296320 5:170501820-170501842 GGGTCACTAGAGGACCCAGTGGG - Intronic
1002145724 5:177179649-177179671 TGCTCATGAGAGCCCCTTGTAGG - Intronic
1006217731 6:32459738-32459760 TGCACACGTAAGCACCCTGTGGG - Intergenic
1013946355 6:115727763-115727785 ACATCATGAGAGCACCCTGTGGG - Intergenic
1015344859 6:132144568-132144590 GACTCAGGAGAGCACTATGTAGG - Intergenic
1017098193 6:150823970-150823992 GGCTCACGTGAGCACCGGGCAGG - Intronic
1018201552 6:161400074-161400096 GCCTCACGTGGGCACCATGTTGG + Intronic
1019633749 7:2064476-2064498 GGCTCACAAGAGCTGCCTCTGGG + Intronic
1021109812 7:16680717-16680739 GGATCACTTGAGCACCCTGGAGG + Intronic
1029147071 7:98454043-98454065 AGCTCAGGAGAGCACCCTTCCGG - Intergenic
1039788841 8:40857954-40857976 GGCAGACGAGACCACCCTATAGG + Intronic
1041150420 8:54926421-54926443 ACATCAAGAGAGCACCCTGTGGG + Intergenic
1049304511 8:141893785-141893807 AGCTCAGAGGAGCACCCTGTGGG - Intergenic
1050073594 9:1841243-1841265 GGGTCACGAGAGCTCCTGGTTGG - Intergenic
1051687603 9:19675037-19675059 ACCTCAAGGGAGCACCCTGTGGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1058578195 9:106425845-106425867 GGCTCAAGAGAGCAGCATTTTGG + Intergenic
1059914908 9:119088145-119088167 GGGTCTCCAAAGCACCCTGTGGG - Intergenic
1061094907 9:128450929-128450951 GCCTTAAGAGAGCACCCAGTAGG + Intergenic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG + Intergenic
1190324162 X:49196374-49196396 GGCTCAAGTGATCACCCAGTGGG - Intronic
1196234435 X:113262104-113262126 GGCTCAGGAGATCCCCTTGTGGG - Intergenic
1200150186 X:153947464-153947486 GGCTCACGGGAGCCCCCTGGAGG - Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic