ID: 1094819396

View in Genome Browser
Species Human (GRCh38)
Location 12:34212699-34212721
Sequence GGTTATCTGCAGATAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094819396_1094819400 -2 Left 1094819396 12:34212699-34212721 CCTGCCATTATCTGCAGATAACC No data
Right 1094819400 12:34212720-34212742 CCATTCTTCTTTGGAGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094819396 Original CRISPR GGTTATCTGCAGATAATGGC AGG (reversed) Intergenic
No off target data available for this crispr