ID: 1094820306

View in Genome Browser
Species Human (GRCh38)
Location 12:34219244-34219266
Sequence CCGCTCATGCCCACCGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094820306_1094820313 -2 Left 1094820306 12:34219244-34219266 CCGGGTCCGGTGGGCATGAGCGG No data
Right 1094820313 12:34219265-34219287 GGGCGAGGAAACTAGGTTCCGGG No data
1094820306_1094820314 7 Left 1094820306 12:34219244-34219266 CCGGGTCCGGTGGGCATGAGCGG No data
Right 1094820314 12:34219274-34219296 AACTAGGTTCCGGGTATAACAGG No data
1094820306_1094820312 -3 Left 1094820306 12:34219244-34219266 CCGGGTCCGGTGGGCATGAGCGG No data
Right 1094820312 12:34219264-34219286 CGGGCGAGGAAACTAGGTTCCGG No data
1094820306_1094820317 18 Left 1094820306 12:34219244-34219266 CCGGGTCCGGTGGGCATGAGCGG No data
Right 1094820317 12:34219285-34219307 GGGTATAACAGGAGAAAGGAAGG No data
1094820306_1094820311 -9 Left 1094820306 12:34219244-34219266 CCGGGTCCGGTGGGCATGAGCGG No data
Right 1094820311 12:34219258-34219280 CATGAGCGGGCGAGGAAACTAGG No data
1094820306_1094820318 22 Left 1094820306 12:34219244-34219266 CCGGGTCCGGTGGGCATGAGCGG No data
Right 1094820318 12:34219289-34219311 ATAACAGGAGAAAGGAAGGAAGG No data
1094820306_1094820315 14 Left 1094820306 12:34219244-34219266 CCGGGTCCGGTGGGCATGAGCGG No data
Right 1094820315 12:34219281-34219303 TTCCGGGTATAACAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094820306 Original CRISPR CCGCTCATGCCCACCGGACC CGG (reversed) Intergenic
No off target data available for this crispr