ID: 1094821304

View in Genome Browser
Species Human (GRCh38)
Location 12:34228051-34228073
Sequence CTTGCTCCCAACAGAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094821304_1094821310 3 Left 1094821304 12:34228051-34228073 CCAGTCTCTCTGTTGGGAGCAAG No data
Right 1094821310 12:34228077-34228099 CCCAAAATCTGGCCATAAACTGG 0: 349
1: 368
2: 159
3: 64
4: 130
1094821304_1094821305 -8 Left 1094821304 12:34228051-34228073 CCAGTCTCTCTGTTGGGAGCAAG No data
Right 1094821305 12:34228066-34228088 GGAGCAAGCCCCCCAAAATCTGG 0: 68
1: 147
2: 175
3: 106
4: 129
1094821304_1094821313 15 Left 1094821304 12:34228051-34228073 CCAGTCTCTCTGTTGGGAGCAAG No data
Right 1094821313 12:34228089-34228111 CCATAAACTGGCCCCAAAACTGG 0: 449
1: 287
2: 113
3: 55
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094821304 Original CRISPR CTTGCTCCCAACAGAGAGAC TGG (reversed) Intergenic
No off target data available for this crispr