ID: 1094832750

View in Genome Browser
Species Human (GRCh38)
Location 12:34307927-34307949
Sequence CAGTGAGTGTCGCACCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094832740_1094832750 22 Left 1094832740 12:34307882-34307904 CCTTTGCAAGGCCCCGAGGACAC No data
Right 1094832750 12:34307927-34307949 CAGTGAGTGTCGCACCCAGGGGG No data
1094832743_1094832750 10 Left 1094832743 12:34307894-34307916 CCCGAGGACACTGGCATCGCTGT No data
Right 1094832750 12:34307927-34307949 CAGTGAGTGTCGCACCCAGGGGG No data
1094832744_1094832750 9 Left 1094832744 12:34307895-34307917 CCGAGGACACTGGCATCGCTGTT No data
Right 1094832750 12:34307927-34307949 CAGTGAGTGTCGCACCCAGGGGG No data
1094832742_1094832750 11 Left 1094832742 12:34307893-34307915 CCCCGAGGACACTGGCATCGCTG No data
Right 1094832750 12:34307927-34307949 CAGTGAGTGTCGCACCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094832750 Original CRISPR CAGTGAGTGTCGCACCCAGG GGG Intergenic
No off target data available for this crispr