ID: 1094838498

View in Genome Browser
Species Human (GRCh38)
Location 12:34333331-34333353
Sequence CCTCACATGCACAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094838498_1094838517 28 Left 1094838498 12:34333331-34333353 CCCTCCACACTGTGCATGTGAGG No data
Right 1094838517 12:34333382-34333404 TCTCAACCACGGAGCGTCTCAGG No data
1094838498_1094838513 17 Left 1094838498 12:34333331-34333353 CCCTCCACACTGTGCATGTGAGG No data
Right 1094838513 12:34333371-34333393 GCCTCCCAGGTTCTCAACCACGG No data
1094838498_1094838510 4 Left 1094838498 12:34333331-34333353 CCCTCCACACTGTGCATGTGAGG No data
Right 1094838510 12:34333358-34333380 CGGGGGACCCTGAGCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094838498 Original CRISPR CCTCACATGCACAGTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr