ID: 1094838868

View in Genome Browser
Species Human (GRCh38)
Location 12:34334725-34334747
Sequence GCAGGTGGGGCCTGGTGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094838868_1094838876 -10 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838876 12:34334738-34334760 CCCCACCTGCCGCGCATGCGCGG No data
1094838868_1094838880 -8 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838880 12:34334740-34334762 CCACCTGCCGCGCATGCGCGGGG No data
1094838868_1094838884 7 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838884 12:34334755-34334777 GCGCGGGGTCCCTGGTTCCCTGG No data
1094838868_1094838889 16 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838889 12:34334764-34334786 CCCTGGTTCCCTGGGGTCCCGGG No data
1094838868_1094838886 9 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838886 12:34334757-34334779 GCGGGGTCCCTGGTTCCCTGGGG No data
1094838868_1094838878 -9 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838878 12:34334739-34334761 CCCACCTGCCGCGCATGCGCGGG No data
1094838868_1094838885 8 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838885 12:34334756-34334778 CGCGGGGTCCCTGGTTCCCTGGG No data
1094838868_1094838887 15 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838887 12:34334763-34334785 TCCCTGGTTCCCTGGGGTCCCGG No data
1094838868_1094838883 -1 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094838868 Original CRISPR GCAGGTGGGGCCTGGTGGGG GGG (reversed) Intergenic