ID: 1094838869

View in Genome Browser
Species Human (GRCh38)
Location 12:34334726-34334748
Sequence GGCAGGTGGGGCCTGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094838869_1094838884 6 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838884 12:34334755-34334777 GCGCGGGGTCCCTGGTTCCCTGG No data
1094838869_1094838880 -9 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838880 12:34334740-34334762 CCACCTGCCGCGCATGCGCGGGG No data
1094838869_1094838885 7 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838885 12:34334756-34334778 CGCGGGGTCCCTGGTTCCCTGGG No data
1094838869_1094838878 -10 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838878 12:34334739-34334761 CCCACCTGCCGCGCATGCGCGGG No data
1094838869_1094838887 14 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838887 12:34334763-34334785 TCCCTGGTTCCCTGGGGTCCCGG No data
1094838869_1094838889 15 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838889 12:34334764-34334786 CCCTGGTTCCCTGGGGTCCCGGG No data
1094838869_1094838883 -2 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838869_1094838886 8 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838886 12:34334757-34334779 GCGGGGTCCCTGGTTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094838869 Original CRISPR GGCAGGTGGGGCCTGGTGGG GGG (reversed) Intergenic