ID: 1094838871

View in Genome Browser
Species Human (GRCh38)
Location 12:34334728-34334750
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094838871_1094838884 4 Left 1094838871 12:34334728-34334750 CCCCACCAGGCCCCACCTGCCGC No data
Right 1094838884 12:34334755-34334777 GCGCGGGGTCCCTGGTTCCCTGG No data
1094838871_1094838885 5 Left 1094838871 12:34334728-34334750 CCCCACCAGGCCCCACCTGCCGC No data
Right 1094838885 12:34334756-34334778 CGCGGGGTCCCTGGTTCCCTGGG No data
1094838871_1094838886 6 Left 1094838871 12:34334728-34334750 CCCCACCAGGCCCCACCTGCCGC No data
Right 1094838886 12:34334757-34334779 GCGGGGTCCCTGGTTCCCTGGGG No data
1094838871_1094838883 -4 Left 1094838871 12:34334728-34334750 CCCCACCAGGCCCCACCTGCCGC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838871_1094838889 13 Left 1094838871 12:34334728-34334750 CCCCACCAGGCCCCACCTGCCGC No data
Right 1094838889 12:34334764-34334786 CCCTGGTTCCCTGGGGTCCCGGG No data
1094838871_1094838887 12 Left 1094838871 12:34334728-34334750 CCCCACCAGGCCCCACCTGCCGC No data
Right 1094838887 12:34334763-34334785 TCCCTGGTTCCCTGGGGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094838871 Original CRISPR GCGGCAGGTGGGGCCTGGTG GGG (reversed) Intergenic