ID: 1094838874

View in Genome Browser
Species Human (GRCh38)
Location 12:34334733-34334755
Sequence CATGCGCGGCAGGTGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094838874_1094838887 7 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838887 12:34334763-34334785 TCCCTGGTTCCCTGGGGTCCCGG No data
1094838874_1094838889 8 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838889 12:34334764-34334786 CCCTGGTTCCCTGGGGTCCCGGG No data
1094838874_1094838896 30 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838896 12:34334786-34334808 GTTCACTCCCCCAGAGTGGCTGG No data
1094838874_1094838895 26 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838895 12:34334782-34334804 CCGGGTTCACTCCCCCAGAGTGG No data
1094838874_1094838885 0 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838885 12:34334756-34334778 CGCGGGGTCCCTGGTTCCCTGGG No data
1094838874_1094838883 -9 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838874_1094838884 -1 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838884 12:34334755-34334777 GCGCGGGGTCCCTGGTTCCCTGG No data
1094838874_1094838886 1 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838886 12:34334757-34334779 GCGGGGTCCCTGGTTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094838874 Original CRISPR CATGCGCGGCAGGTGGGGCC TGG (reversed) Intergenic