ID: 1094838883

View in Genome Browser
Species Human (GRCh38)
Location 12:34334747-34334769
Sequence CCGCGCATGCGCGGGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094838864_1094838883 7 Left 1094838864 12:34334717-34334739 CCCTGGCCCCCCCCCACCAGGCC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838867_1094838883 0 Left 1094838867 12:34334724-34334746 CCCCCCCCACCAGGCCCCACCTG No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838868_1094838883 -1 Left 1094838868 12:34334725-34334747 CCCCCCCACCAGGCCCCACCTGC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838865_1094838883 6 Left 1094838865 12:34334718-34334740 CCTGGCCCCCCCCCACCAGGCCC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838874_1094838883 -9 Left 1094838874 12:34334733-34334755 CCAGGCCCCACCTGCCGCGCATG No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838872_1094838883 -5 Left 1094838872 12:34334729-34334751 CCCACCAGGCCCCACCTGCCGCG No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838869_1094838883 -2 Left 1094838869 12:34334726-34334748 CCCCCCACCAGGCCCCACCTGCC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838871_1094838883 -4 Left 1094838871 12:34334728-34334750 CCCCACCAGGCCCCACCTGCCGC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838873_1094838883 -6 Left 1094838873 12:34334730-34334752 CCACCAGGCCCCACCTGCCGCGC No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838870_1094838883 -3 Left 1094838870 12:34334727-34334749 CCCCCACCAGGCCCCACCTGCCG No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data
1094838866_1094838883 1 Left 1094838866 12:34334723-34334745 CCCCCCCCCACCAGGCCCCACCT No data
Right 1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094838883 Original CRISPR CCGCGCATGCGCGGGGTCCC TGG Intergenic