ID: 1094839463

View in Genome Browser
Species Human (GRCh38)
Location 12:34336888-34336910
Sequence AGGCCCTTGCTCTGCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839463_1094839480 28 Left 1094839463 12:34336888-34336910 CCGGCGCGGCAGAGCAAGGGCCT No data
Right 1094839480 12:34336939-34336961 TGCCGCGCATGCGCAGGGTCCGG No data
1094839463_1094839474 22 Left 1094839463 12:34336888-34336910 CCGGCGCGGCAGAGCAAGGGCCT No data
Right 1094839474 12:34336933-34336955 ACCCCCTGCCGCGCATGCGCAGG No data
1094839463_1094839481 29 Left 1094839463 12:34336888-34336910 CCGGCGCGGCAGAGCAAGGGCCT No data
Right 1094839481 12:34336940-34336962 GCCGCGCATGCGCAGGGTCCGGG No data
1094839463_1094839476 23 Left 1094839463 12:34336888-34336910 CCGGCGCGGCAGAGCAAGGGCCT No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
1094839463_1094839483 30 Left 1094839463 12:34336888-34336910 CCGGCGCGGCAGAGCAAGGGCCT No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839463 Original CRISPR AGGCCCTTGCTCTGCCGCGC CGG (reversed) Intergenic