ID: 1094839467

View in Genome Browser
Species Human (GRCh38)
Location 12:34336914-34336936
Sequence GGGTGTGTGGGGTTGGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839467_1094839481 3 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839481 12:34336940-34336962 GCCGCGCATGCGCAGGGTCCGGG No data
1094839467_1094839476 -3 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
1094839467_1094839483 4 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839467_1094839484 17 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839484 12:34336954-34336976 GGGTCCGGGGTTCGCGCTGCCGG No data
1094839467_1094839486 26 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839467_1094839480 2 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839480 12:34336939-34336961 TGCCGCGCATGCGCAGGGTCCGG No data
1094839467_1094839474 -4 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839474 12:34336933-34336955 ACCCCCTGCCGCGCATGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839467 Original CRISPR GGGTGTGTGGGGTTGGCCAG GGG (reversed) Intergenic