ID: 1094839470

View in Genome Browser
Species Human (GRCh38)
Location 12:34336921-34336943
Sequence CGGCAGGGGGTGTGTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839470_1094839480 -5 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839480 12:34336939-34336961 TGCCGCGCATGCGCAGGGTCCGG No data
1094839470_1094839484 10 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839484 12:34336954-34336976 GGGTCCGGGGTTCGCGCTGCCGG No data
1094839470_1094839481 -4 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839481 12:34336940-34336962 GCCGCGCATGCGCAGGGTCCGGG No data
1094839470_1094839490 30 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839490 12:34336974-34336996 CGGAGTTGCTGGACACCGCGGGG No data
1094839470_1094839476 -10 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG 0: 1
1: 1
2: 5
3: 21
4: 89
1094839470_1094839483 -3 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839470_1094839487 28 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839487 12:34336972-34336994 GCCGGAGTTGCTGGACACCGCGG No data
1094839470_1094839489 29 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839470_1094839486 19 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839470 Original CRISPR CGGCAGGGGGTGTGTGGGGT TGG (reversed) Intergenic