ID: 1094839472

View in Genome Browser
Species Human (GRCh38)
Location 12:34336926-34336948
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839472_1094839483 -8 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839472_1094839487 23 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839487 12:34336972-34336994 GCCGGAGTTGCTGGACACCGCGG No data
1094839472_1094839493 30 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839493 12:34336979-34337001 TTGCTGGACACCGCGGGGGGCGG No data
1094839472_1094839484 5 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839484 12:34336954-34336976 GGGTCCGGGGTTCGCGCTGCCGG No data
1094839472_1094839481 -9 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839481 12:34336940-34336962 GCCGCGCATGCGCAGGGTCCGGG No data
1094839472_1094839490 25 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839490 12:34336974-34336996 CGGAGTTGCTGGACACCGCGGGG No data
1094839472_1094839492 27 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839492 12:34336976-34336998 GAGTTGCTGGACACCGCGGGGGG No data
1094839472_1094839489 24 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839472_1094839486 14 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839472_1094839480 -10 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839480 12:34336939-34336961 TGCCGCGCATGCGCAGGGTCCGG No data
1094839472_1094839491 26 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839491 12:34336975-34336997 GGAGTTGCTGGACACCGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839472 Original CRISPR ATGCGCGGCAGGGGGTGTGT GGG (reversed) Intergenic