ID: 1094839473

View in Genome Browser
Species Human (GRCh38)
Location 12:34336927-34336949
Sequence CATGCGCGGCAGGGGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839473_1094839490 24 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839490 12:34336974-34336996 CGGAGTTGCTGGACACCGCGGGG No data
1094839473_1094839481 -10 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839481 12:34336940-34336962 GCCGCGCATGCGCAGGGTCCGGG No data
1094839473_1094839489 23 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839473_1094839484 4 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839484 12:34336954-34336976 GGGTCCGGGGTTCGCGCTGCCGG No data
1094839473_1094839483 -9 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839473_1094839491 25 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839491 12:34336975-34336997 GGAGTTGCTGGACACCGCGGGGG No data
1094839473_1094839487 22 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839487 12:34336972-34336994 GCCGGAGTTGCTGGACACCGCGG No data
1094839473_1094839486 13 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839473_1094839493 29 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839493 12:34336979-34337001 TTGCTGGACACCGCGGGGGGCGG No data
1094839473_1094839492 26 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839492 12:34336976-34336998 GAGTTGCTGGACACCGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839473 Original CRISPR CATGCGCGGCAGGGGGTGTG TGG (reversed) Intergenic