ID: 1094839474

View in Genome Browser
Species Human (GRCh38)
Location 12:34336933-34336955
Sequence ACCCCCTGCCGCGCATGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839463_1094839474 22 Left 1094839463 12:34336888-34336910 CCGGCGCGGCAGAGCAAGGGCCT No data
Right 1094839474 12:34336933-34336955 ACCCCCTGCCGCGCATGCGCAGG No data
1094839466_1094839474 2 Left 1094839466 12:34336908-34336930 CCTTGGCCCCTGGCCAACCCCAC No data
Right 1094839474 12:34336933-34336955 ACCCCCTGCCGCGCATGCGCAGG No data
1094839467_1094839474 -4 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839474 12:34336933-34336955 ACCCCCTGCCGCGCATGCGCAGG No data
1094839469_1094839474 -6 Left 1094839469 12:34336916-34336938 CCTGGCCAACCCCACACACCCCC No data
Right 1094839474 12:34336933-34336955 ACCCCCTGCCGCGCATGCGCAGG No data
1094839468_1094839474 -5 Left 1094839468 12:34336915-34336937 CCCTGGCCAACCCCACACACCCC No data
Right 1094839474 12:34336933-34336955 ACCCCCTGCCGCGCATGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839474 Original CRISPR ACCCCCTGCCGCGCATGCGC AGG Intergenic