ID: 1094839475

View in Genome Browser
Species Human (GRCh38)
Location 12:34336934-34336956
Sequence CCCTGCGCATGCGCGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839475_1094839487 15 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839487 12:34336972-34336994 GCCGGAGTTGCTGGACACCGCGG No data
1094839475_1094839486 6 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839475_1094839489 16 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839475_1094839492 19 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839492 12:34336976-34336998 GAGTTGCTGGACACCGCGGGGGG No data
1094839475_1094839490 17 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839490 12:34336974-34336996 CGGAGTTGCTGGACACCGCGGGG No data
1094839475_1094839491 18 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839491 12:34336975-34336997 GGAGTTGCTGGACACCGCGGGGG No data
1094839475_1094839493 22 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839493 12:34336979-34337001 TTGCTGGACACCGCGGGGGGCGG No data
1094839475_1094839484 -3 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839484 12:34336954-34336976 GGGTCCGGGGTTCGCGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839475 Original CRISPR CCCTGCGCATGCGCGGCAGG GGG (reversed) Intergenic