ID: 1094839476

View in Genome Browser
Species Human (GRCh38)
Location 12:34336934-34336956
Sequence CCCCCTGCCGCGCATGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839468_1094839476 -4 Left 1094839468 12:34336915-34336937 CCCTGGCCAACCCCACACACCCC No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
1094839470_1094839476 -10 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
1094839467_1094839476 -3 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
1094839463_1094839476 23 Left 1094839463 12:34336888-34336910 CCGGCGCGGCAGAGCAAGGGCCT No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
1094839466_1094839476 3 Left 1094839466 12:34336908-34336930 CCTTGGCCCCTGGCCAACCCCAC No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
1094839469_1094839476 -5 Left 1094839469 12:34336916-34336938 CCTGGCCAACCCCACACACCCCC No data
Right 1094839476 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839476 Original CRISPR CCCCCTGCCGCGCATGCGCA GGG Intergenic