ID: 1094839482

View in Genome Browser
Species Human (GRCh38)
Location 12:34336941-34336963
Sequence CCCCGGACCCTGCGCATGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839482_1094839496 29 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839496 12:34336993-34337015 GGGGGGCGGCCCAAAGAGGCAGG No data
1094839482_1094839497 30 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839497 12:34336994-34337016 GGGGGCGGCCCAAAGAGGCAGGG No data
1094839482_1094839486 -1 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839482_1094839493 15 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839493 12:34336979-34337001 TTGCTGGACACCGCGGGGGGCGG No data
1094839482_1094839490 10 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839490 12:34336974-34336996 CGGAGTTGCTGGACACCGCGGGG No data
1094839482_1094839495 25 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839495 12:34336989-34337011 CCGCGGGGGGCGGCCCAAAGAGG No data
1094839482_1094839492 12 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839492 12:34336976-34336998 GAGTTGCTGGACACCGCGGGGGG No data
1094839482_1094839489 9 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839482_1094839484 -10 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839484 12:34336954-34336976 GGGTCCGGGGTTCGCGCTGCCGG No data
1094839482_1094839487 8 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839487 12:34336972-34336994 GCCGGAGTTGCTGGACACCGCGG No data
1094839482_1094839491 11 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839491 12:34336975-34336997 GGAGTTGCTGGACACCGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839482 Original CRISPR CCCCGGACCCTGCGCATGCG CGG (reversed) Intergenic