ID: 1094839483

View in Genome Browser
Species Human (GRCh38)
Location 12:34336941-34336963
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839463_1094839483 30 Left 1094839463 12:34336888-34336910 CCGGCGCGGCAGAGCAAGGGCCT No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839468_1094839483 3 Left 1094839468 12:34336915-34336937 CCCTGGCCAACCCCACACACCCC No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839466_1094839483 10 Left 1094839466 12:34336908-34336930 CCTTGGCCCCTGGCCAACCCCAC No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839471_1094839483 -7 Left 1094839471 12:34336925-34336947 CCCCACACACCCCCTGCCGCGCA No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839472_1094839483 -8 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839469_1094839483 2 Left 1094839469 12:34336916-34336938 CCTGGCCAACCCCACACACCCCC No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839473_1094839483 -9 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839467_1094839483 4 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
1094839470_1094839483 -3 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839483 Original CRISPR CCGCGCATGCGCAGGGTCCG GGG Intergenic