ID: 1094839485

View in Genome Browser
Species Human (GRCh38)
Location 12:34336958-34336980
Sequence AACTCCGGCAGCGCGAACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839485_1094839497 13 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839497 12:34336994-34337016 GGGGGCGGCCCAAAGAGGCAGGG No data
1094839485_1094839496 12 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839496 12:34336993-34337015 GGGGGGCGGCCCAAAGAGGCAGG No data
1094839485_1094839501 26 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839501 12:34337007-34337029 AGAGGCAGGGATCCTTGAAAGGG No data
1094839485_1094839489 -8 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839485_1094839503 30 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839503 12:34337011-34337033 GCAGGGATCCTTGAAAGGGGAGG No data
1094839485_1094839493 -2 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839493 12:34336979-34337001 TTGCTGGACACCGCGGGGGGCGG No data
1094839485_1094839487 -9 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839487 12:34336972-34336994 GCCGGAGTTGCTGGACACCGCGG No data
1094839485_1094839495 8 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839495 12:34336989-34337011 CCGCGGGGGGCGGCCCAAAGAGG No data
1094839485_1094839492 -5 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839492 12:34336976-34336998 GAGTTGCTGGACACCGCGGGGGG No data
1094839485_1094839502 27 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839502 12:34337008-34337030 GAGGCAGGGATCCTTGAAAGGGG No data
1094839485_1094839490 -7 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839490 12:34336974-34336996 CGGAGTTGCTGGACACCGCGGGG No data
1094839485_1094839500 25 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839500 12:34337006-34337028 AAGAGGCAGGGATCCTTGAAAGG No data
1094839485_1094839491 -6 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839491 12:34336975-34336997 GGAGTTGCTGGACACCGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839485 Original CRISPR AACTCCGGCAGCGCGAACCC CGG (reversed) Intergenic