ID: 1094839486

View in Genome Browser
Species Human (GRCh38)
Location 12:34336963-34336985
Sequence GTTCGCGCTGCCGGAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839479_1094839486 3 Left 1094839479 12:34336937-34336959 CCTGCCGCGCATGCGCAGGGTCC No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839470_1094839486 19 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839478_1094839486 4 Left 1094839478 12:34336936-34336958 CCCTGCCGCGCATGCGCAGGGTC No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839471_1094839486 15 Left 1094839471 12:34336925-34336947 CCCCACACACCCCCTGCCGCGCA No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839475_1094839486 6 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839482_1094839486 -1 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839477_1094839486 5 Left 1094839477 12:34336935-34336957 CCCCTGCCGCGCATGCGCAGGGT No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839467_1094839486 26 Left 1094839467 12:34336914-34336936 CCCCTGGCCAACCCCACACACCC No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839473_1094839486 13 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839468_1094839486 25 Left 1094839468 12:34336915-34336937 CCCTGGCCAACCCCACACACCCC No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839469_1094839486 24 Left 1094839469 12:34336916-34336938 CCTGGCCAACCCCACACACCCCC No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data
1094839472_1094839486 14 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839486 12:34336963-34336985 GTTCGCGCTGCCGGAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839486 Original CRISPR GTTCGCGCTGCCGGAGTTGC TGG Intergenic