ID: 1094839489

View in Genome Browser
Species Human (GRCh38)
Location 12:34336973-34336995
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094839477_1094839489 15 Left 1094839477 12:34336935-34336957 CCCCTGCCGCGCATGCGCAGGGT No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839470_1094839489 29 Left 1094839470 12:34336921-34336943 CCAACCCCACACACCCCCTGCCG No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839482_1094839489 9 Left 1094839482 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839471_1094839489 25 Left 1094839471 12:34336925-34336947 CCCCACACACCCCCTGCCGCGCA No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839478_1094839489 14 Left 1094839478 12:34336936-34336958 CCCTGCCGCGCATGCGCAGGGTC No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839472_1094839489 24 Left 1094839472 12:34336926-34336948 CCCACACACCCCCTGCCGCGCAT No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839479_1094839489 13 Left 1094839479 12:34336937-34336959 CCTGCCGCGCATGCGCAGGGTCC No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839485_1094839489 -8 Left 1094839485 12:34336958-34336980 CCGGGGTTCGCGCTGCCGGAGTT No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839475_1094839489 16 Left 1094839475 12:34336934-34336956 CCCCCTGCCGCGCATGCGCAGGG No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data
1094839473_1094839489 23 Left 1094839473 12:34336927-34336949 CCACACACCCCCTGCCGCGCATG No data
Right 1094839489 12:34336973-34336995 CCGGAGTTGCTGGACACCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094839489 Original CRISPR CCGGAGTTGCTGGACACCGC GGG Intergenic